.jpeg)
32. Longest Valid Parentheses
.jpeg)
Given a string containing just the characters ‘(‘ and ‘)’, return the length of the longest valid (well-formed) parentheses substring.
Example 1:
1 | Input: s = "(()" |
Example 2:
1 | Input: s = ")()())" |
Example 3:
1 | Input: s = "" |
605. Can Place Flowers
.jpeg)
You have a long flowerbed in which some of the plots are planted, and some are not. However, flowers cannot be planted in adjacent plots.
Given an integer array flowerbed containing 0’s and 1’s, where 0 means empty and 1 means not empty, and an integer n, return if n new flowers can be planted in the flowerbed without violating the no-adjacent-flowers rule.
Example 1:
1 | Input: flowerbed = [1,0,0,0,1], n = 1 |
Example 2:
1 | Input: flowerbed = [1,0,0,0,1], n = 2 |
白酒
187. Repeated DNA Sequences
.jpeg)
The DNA sequence is composed of a series of nucleotides abbreviated as ‘A’, ‘C’, ‘G’, and ‘T’.
For example, “ACGAATTCCG” is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1:
1 | Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" |
Example 2:
1 | Input: s = "AAAAAAAAAAAAA" |
.jpeg)